Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.

Skip to main content
  • Research Letter
  • Open access
  • Published:

Apoptosis-promoting properties of miR-3074-5p in MC3T3-E1 cells under iron overload conditions

Abstract

Background

Iron overload can promote the development of osteoporosis by inducing apoptosis in osteoblasts. However, the mechanism by which miRNAs regulate apoptosis in osteoblasts under iron overload has not been elucidated.

Method

The miRNA expression profile in MC3T3-E1 cells under iron overload was detected by next generation sequencing. qRT-PCR was used to determine the expression of miR-3074-5p in MC3T3-E1 cells under iron overload. The proliferation of MC3T3-E1 cells was tested using CCK-8 assays, and apoptosis was measured using flow cytometry. The miRanda and TargetScan databases were used to predict the target genes of miR-3074-5p. Interaction between miR-3074-5p and the potential target gene was validated by qRT-PCR, luciferase reporter assay and western blotting.

Results

We found that iron overload decreased the cell viability and induced apoptosis of MC3T3-E1 cells. The results of next generation sequencing analysis showed that miR-3074-5p expression was significantly increased in MC3T3-E1 cells under iron overload conditions, which was confirmed by further experiments. The inhibition of miR-3074-5p attenuated the apoptosis of iron-overloaded MC3T3-E1 cells. Furthermore, the expression of Smad4 was decreased and was inversely correlated with miR-3074-5p expression, and overexpression of Smad4 partially reversed the viability inhibition of iron-overloaded MC3T3-E1 cells by relieving the suppression of ERK, AKT, and Stat3 phosphorylation, suggesting its regulatory role in the viability inhibition of iron-overloaded MC3T3-E1 cells. The luciferase reporter assay results showed that Smad4 was the target gene of miR-3074-5p.

Conclusion

miR-3074-5p functions as an apoptosis promoter in iron-overloaded MC3T3-E1 cells by directly targeting Smad4.

Background

Iron is one of the essential nutrients for mammals. However, iron accumulation in tissues, which is characteristic of the elderly, is a risk factor for infection, osteoporosis, and several chronic diseases [1]. Osteoporosis is a systemic disease that causes reduced bone strength and an increased risk of fracture, which is caused by reduced bone mass and bone microstructure destruction. Fracturing is a serious consequence of osteoporosis, which can significantly increase the morbidity and mortality of patients, and cause considerable family and socioeconomic burdens [2]. Evidence from several studies has demonstrated that iron overload directly inhibits bone remodeling [3,4,5]. In a study of fifty patients with osteoporosis, 88% of them were iron overloaded, suggesting that iron overload may play a role in promoting the development and progression of osteoporosis [6]. The steady state of the skeletal system depends on the dynamic equilibrium between osteoblast-mediated osteogenesis and osteoclast-mediated bone destruction in bone metabolism. When the number or function of osteoblasts decreased, bone formation was less than resorption, resulting in loss of alveolar bone mass. Many in vivo and in vitro studies have suggested that iron overload could reduce bone formation and increase bone resorption, which is associated with pathological bone loss [7,8,9]. Cell studies in vitro have found that iron overload induced osteoblast apoptosis by increasing intracellular reactive oxygen species and activating the mitochondrial apoptosis pathway [10,11,12].

miRNAs are a class of endogenous non-coding single-stranded small RNAs with a length of approximately 20–22 nucleotides. These RNAs play a key role in cell metabolism, proliferation, autophagy, apoptosis, differentiation and other biological processes, and their expression changes are related to many human diseases [13,14,15]. Studies have shown that miRNAs participate in regulating apoptosis. Several apoptosis-related genes are regulated by miRNAs [16,17,18]. miR-1 promoted nitric oxide-induced apoptosis of MC3T3-E1 cells by targeting HSP-70 [19]. miR-214 alleviated apoptosis of H2O2-treated MC3T3-E1 cells by suppressing oxidative stress [20]. However, the mechanism by which miRNAs regulate apoptosis in MC3T3-E1 cells under iron overload has not been reported.

The present study used an iron overload model of MC3T3-E1 cells induced by a high concentration of ferric ammonium citrate (FAC) to simulate an environment of iron overload and analyzed the miRNA expression profiles in MC3T3-E1 cells under iron overload conditions. The results showed that increased miR-3074-5p due to iron overload caused apoptosis of MC3T3-E1 cells. Overexpression of miR-3074-5p inhibited Smad4 in MC3T3-E1 cells. Restoration of Smad4 rescued the effects of miR-3074-5p in FAC-treated MC3T3-E1 cells. The present data show the apoptosis-promoting properties of miR-3074-5p by regulating its downstream gene target Smad4 in MC3T3-E1 cells under iron overload in vitro.

Methods

Cell culture, drug treatment, and transfection

The murine preosteoblast cell line MC3T3-E1 was obtained from American Type Culture Collection (Manassas, VA, USA) and stored at the Department of Biochemistry, Medical College of Jinan University (Guangzhou, China). MC3T3-E1 cells were cultured in α-MEM (Gibco-BRL, Gaithersburg, MD, USA) containing 10% fetal bovine serum at 37 °C in an incubator with 5% carbon dioxide [21]. To simulate an in vitro environment of iron overload (iron overload conditions), cells were treated with 0, 0.6, 1.2, 1.8, 2.4 and 3.0 mM ferric ammonium citrate (FAC; Sangon, Shanghai, China). After exposure to FAC for specified times, all samples were collected for the following experiments. To overexpress and block miR-3074-5p in MC3T3-E1 cells, cells were transfected with miR-3074-5p mimic, inhibitor, and the negative control (Ribo, Guangzhou, China) separately at a working concentration of 100 nM using the Ribo FECT CP Transfection Kit (Ribo, Guangzhou, China) following the manufacturer’s guidelines. miRNA inhibitor is a chemically synthesized 21–23 nt oligonucleotide modified by 2ʹ-methoxy, which can specifically bind to mature miRNA to reduce its regulatory effect in cells. The sequences of mimic, mimic NC, inhibitor and inhibitor NC used are shown in Table 1. To overexpress Smad4 in MC3T3-E1 cells, the cells were transfected with pcDNA3.1-Smad4 and a pcDNA3.1-negative control using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Intracellular expression of Smad4 was confirmed by western blot analysis.

Table 1 Sequences of mimic, mimic NC, inhibitor, and inhibitor NC

Cell viability measurement

Cell viability was detected using a CCK-8 assay (Sigma-Aldrich, St Louis, USA). MC3T3-E1 cells were cultured in 96-well plates at 3 × 103 cells per well. After 24, 48 and 72 h of FAC treatment, the cell inhibition rate was determined with a CCK-8 assay following the manufacturer’s guidelines [22]. Cell inhibition rate = (1 − mean of OD values of the treatment group/mean of OD values of the control group) × 100%.

Hoechst staining to detect apoptosis-related morphologic changes

MC3T3-E1 cells were cultured in 6-well plates at 5 × 104 cells per well. After 24 h of 0 and 1.8 mM FAC treatment for 24 h, the cells were fixed. A Hoechst 33,258 staining kit (Beyotime, Shanghai, China) was used for cell staining [23]. Observation of apoptotic cells was carried out with a fluorescence microscope (Olympus, Tokyo, Japan) at a 350 nm excitation wavelength and 460 nm emission wavelength.

Annexin V-FITC/PI staining to determine apoptosis

Apoptosis of MC3T3-E1 cells was determined using an Annexin V-FITC/PI Kit (Beyotime, Shanghai, China). In brief, cells were seeded into 6-well plates at 2.0 × 104 cells/well. After treatment with 0, 0.6, 1.2, 1.8 and 2.4 mM FAC for 24 h, the cells were collected, incubated with Annexin V-FITC and PI following the manufacturer’s guidelines [24], and finally analyzed on a FACSCalibur flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA, USA).

Western blotting

The total protein in cells was extracted and the concentration was assessed. Western blotting was conducted as described previously [25]. Antibodies against caspase 3, cleaved caspase-3, XIAP, c-IAP2, survivin, AKT, p-AKT, ERK, p-ERK, Stat3, p-Stat3, Smad4, and GAPDH were all obtained from Cell Signaling Technology Co., Ltd. (Danvers, MA, USA).

miRNA profiling

The total RNA was isolated from MC3T3-E1 cells treated with or without 1.8 mM FAC for 24 h. miRNA next-generation sequencing analysis was carried out by BGI Genomics Co., Ltd (Shenzhen, China). Different expression of miRNAs between MC3T3-E1 cells treated without FAC (control group) and with FAC (FAC group) was identified through the log2Ratio (FAC/Control), which was calculated as the log2 value of the fold change, with threshold sets for up- and downregulated genes of a log2Ratio (FAC/Control) ≥ 1.0 or ≤ 1.0 with a P value < 0.05.

qRT-PCR

The total RNA was isolated using TRIzol reagent (Keygen, Jiangsu, China). cDNA was synthesized from mRNA with the cDNA Synthesis SuperMix (Bimake, Houston, TX, USA) and from miRNA with a Reverse Transcription Kit (Ribo, Guangzhou, China). qPCR was performed to detect the expression levels of miR-3074-5p and Smad4 using the Bulge-Loop miRNA qRT-PCR Starter Kit (Ribo, Guangzhou, China) and 2 × SYBR Green qPCR Master Mix (Bimake, Houston, TX, USA) [26], respectively. The specific primers used are shown in Table 2. U6 and GAPDH were used as internal controls of miRNA and mRNA, respectively.

Table 2 Primer sequences for qRT-PCR

Bioinformatics analysis

To understand the function of differentially expressed miRNAs in MC3T3 cells treated with or without FAC, KEGG pathway analysis was conducted to perform pathway enrichment analysis. In this study, enrichment factors of KEGG pathways in the top 20 were chosen and shown. Two bioinformatics software programs, TargetScan and miRanda, were used for target gene prediction. The intersection of their prediction results was taken as the final result.

Dual-luciferase report gene assay

A wide-type 3ʹ-UTR fragment of Smad4 mRNA (5ʹ…CUGUCAUGAGUGGAGCAGGAAG…3ʹ) containing a putative miR-3074-5p-binding site (position 2954–2960) was cloned into the psiCHECK2 vector, named WT-Smad4-3ʹ-UTR luciferase vector. The mutation of the 3ʹ-UTR fragment of Smad4 mRNA (5ʹ…CUGUCAUGAGUGGAGCUCCAAG…3ʹ) was constructed using the QuickChange mutagenesis kit (Agilent Technologies, California, USA) and cloned into the psiCHECK2 vector to construct the MUT–Smad4-3ʹ-UTR luciferase vector [22]. HEK293T cells were transfected with psiCHECK2 reporter plasmids containing either the wild-type or mutant type of the 3ʹUTR of Smad4 in the presence of miR-3074-5p mimic and NC using Lipofectamine 2000, and cultured for 48 h before being harvested for experiments and analysis. The relative luciferase activity was implemented using the Dual-Luciferase Reporter Assay Kit (Yeasen, Shanghai, China).

Statistical analysis

Quantitative data were expressed as the mean ± SD. SPSS 17.0 software (SPSS, Chicago, IL, USA) and GraphPad Prism 7.0 (GraphPad, San Diego, CA, USA) were used for statistical analysis. Independent samples t tests (unpaired t-tests) were performed for comparisons between two groups. One-way ANOVA was performed for comparisons among groups. P < 0.05 was considered to indicate statistical significance.

Results

Iron overload decreased the viability and induced apoptosis of MC3T3-E1 cells

After exposing MC3T3-E1 cells to FAC (0, 0.6, 1.2, 1.8, 2.4 and 3.0 mM) separately for 24, 48 and 72 h, the CCK-8 assay revealed that FAC at each concentration inhibited the proliferation of MC3T3-E1 cells in a concentration- and time-dependent manner, compared with the untreated control group (P < 0.05) (Fig. 1a). To observe the morphological changes of FAC-treated MC3T3-E1 cells, cells treated with 0 and 1.8 mM FAC separately for 24 h were stained with a Hoechst 33,258 Staining Kit. The results of Hoechst staining showed that the nuclei of apoptotic MC3T3-E1 cells treated with 1.8 mM FAC were densely stained, which was the typical morphological change of apoptotic cells (Fig. 1b, c). To assess whether iron overload mediated cytotoxicity in MC3T3-E1 cells was related to apoptosis, Annexin V-FITC/PI staining was used to detect the apoptosis rate of MC3T3-E1 cells. Flow cytometry analysis showed that the late apoptosis rate increased from 1.63 to 61.85% as FAC concentrations increased from 0 mM to 2.4 mM, suggesting a dose-dependent effect of FAC on apoptosis in MC3T3-E1 cells (Fig. 1d). To confirm that iron overload did induce apoptosis of MC3T3-E1 cells at the protein level, the expression of apoptosis-related proteins in MC3T3-E1 cells was evaluated by western blot analysis. In this study, dose-dependent downregulation of XIAP, c-IAP2, survivin, p-AKT, p-ERK and p-Stat3, as well as upregulation of cleaved-caspase 3, was observed in MC3T3-E1 cells (0.6–1.8 mM FAC) for 24 h (Fig. 1e). All of the results demonstrate that iron overload promotes apoptosis of MC3T3-E1 cells.

Fig. 1
figure 1

Iron overload decreased the viability and increased the apoptosis rate of MC3T3-E1 cells. A The viability of MC3T3-E1 cells was evaluated by CCK-8 assay after exposure to FAC (0–3.0 mM) for 24, 48 and 72 h. *P < 0.05 vs. the control. B MC3T3-E1 cells were treated with 0 and 1.8 mM FAC for 24 h. The nuclei of apoptotic cells treated with 1.8 mM FAC were densely stained with Hoechst 33,258, and were condensed and bright. Scale bars: 100 μm. C Quantitative analysis of apoptosis based on Hoechst 33,258 staining. *P < 0.05 vs. the control. D Cells were exposed to FAC (0–2.4 mM) for 24 h. Apoptotic MC3T3-E1 cells stained with Annexin V/PI were determined by flow cytometric analysis. E Apoptosis-related protein expression levels of cells were evaluated by western blot analysis after exposure to 0–1.8 mM FAC for 24 h

Iron overload induced miR-3074-5p expression in MC3T3-E1 cells

Differentially expressed miRNAs between MC3T3-E1 cells treated with and without 1.8 mM FAC for 24 h were identified via miRNA next-generation sequencing analysis (Fig. 2a). The raw data from the analysis have been deposited into the NCBI SRA database under the accession code PRJNA506880. We focused on miR-3074-5p, which displayed significant upregulation in iron-overloaded MC3T3-E1 cells, compared with the control group (P < 0.05). In order to validate this result, we examined the expression profile of miR-3074-5p in MC3T3-E1 cells treated with and without 1.8 mM FAC for 24 h. The qRT-PCR results showed that miR-3074-5p expression significantly increased in MC3T3-E1 cells exposed to FAC, compared to the untreated control group (P < 0.05) (Fig. 2b). We also found that cells transfected with miR-3074-5p inhibitor could rescue FAC-induced miR-3074-5p upregulation in MC3T3-E1 cells (Fig. 2c). The above results suggest a potential function of miR-3074-5p in MC3T3-E1 cells under iron overload.

Fig. 2
figure 2

miR-3074-5p expression was increased in MC3T3-E1 cells under iron overload conditions. A Heatmap of 18 miRNAs displaying significant upregulation (red pixels) or downregulation (green pixels) in MC3T3-E1 cells treated with 1.8 mM FAC, compared with the control. B, C miR-3074-5p expression was validated by qRT-PCR. Inhibitor indicated miR-3074-5p inhibitor. NC indicates the negative control. *P < 0.05 vs. the NC group. #P < 0.05 vs. the NC + FAC group

miR-3074-5p mediated iron overload-induced apoptosis of MC3T3-E1 cells

To explore the biological impact of miR-3074-5p on the apoptosis of MC3T3-E1 cells under iron overload conditions, gain- and loss-of-function experiments were performed by transfecting cells with a miR-3074-5p mimic or inhibitor, respectively. The CCK-8 assay was employed to define the effects of miR-3074-5p on cell viability and Annexin V-FITC/PI staining was performed to confirm the function of miR-3074-5p in cell apoptosis. The results revealed a significant increase in the inhibition rate of miR-3074-5p mimic-treated MC3T3-E1 cells under iron overload conditions (mimic + FAC group) compared with the negative control (NC)-treated MC3T3-E1 cells in the iron overload group (NC + FAC group) and the NC only group (P < 0.05). There was a significant decrease in the inhibition rate of miR-3074-5p inhibitor-treated MC3T3-E1 cells under iron overload (inhibitor + FAC group) compared with the negative control (NC)-treated MC3T3-E1 cells under iron overload (NC + FAC group) (P < 0.05) (Fig. 3a). Consistently, the apoptosis rate was increased in MC3T3-E1 cells transfected with the miR-3074-5p mimic under iron overload (mimic + FAC group) compared with the negative control (NC)-treated MC3T3-E1 cells in the iron overload group (NC + FAC group) and the NC only group (P < 0.05). Conversely, the apoptosis rate was decreased in cells that were transfected with the miR-3074-5p inhibitor under iron overload (inhibitor + FAC group), compared with the negative control (NC)-treated MC3T3-E1 cells under iron overload (NC + FAC group) (P < 0.05) (Fig. 3b). These results clearly indicate that aberrant expression of miR-3074-5p contributes to apoptosis of iron-overloaded MC3T3-E1 cells.

Fig. 3
figure 3

miR-3074-5p mediated the apoptosis of MC3T3-E1 cells under iron overload conditions. A Gain- and loss-of-function experiments were performed by transfecting cells with a miR-3074-5p mimic and miR-3074-5p inhibitor, respectively. The CCK-8 assay was used to investigate the effect of miR-3074-5p on cell viability. *P < 0.05 vs. the NC. #P < 0.05 vs. the NC + FAC group. ns P > 0.05 vs. the NC group. FAC concentration: 1.8 mM. B Annexin V-FITC/PI staining was performed to confirm the function of miR-3074-5p in cell apoptosis. C Quantitative analysis of late apoptosis rate based on Annexin V-FITC/PI staining. *P < 0.05 vs. the NC. #P < 0.05 vs. the NC + FAC group. ns P > 0.05 vs. the NC group

Results of bioinformatic analysis

KEGG pathway analysis showed the target mRNAs of the differentially expressed miRNAs in MC3T3 cells treated with or without FAC. The top 20 enriched pathways with P < 0.05 were chosen and are shown (Additional file 1: Fig. S1a). Notably, these target genes of the differentially expressed miRNAs were enriched in two cellular survival- and death-related pathways, the FoxO signaling pathway and the mTOR signaling pathway (Additional file 1: Fig. S1a). Target mRNAs of miR-3074-5p were predicted with the miRanda and TargetScan databases. Eight hundred and sixty-four targets were identified by TargetScan and 450 targets were identified by miRanda; 314 targets overlapped between the two database. Among the predicted target genes, Smad4 was related to the FoxO signaling pathway and Jmjd8 was related to the mTOR signaling pathway (Additional file 1: Fig. S1b).

miR-3074-5p targeted Smad4 in MC3T3-E1 cells

Further experiments are required to explore the molecular mechanisms linking miR-3074-5p with apoptosis of iron-overloaded MC3T3-E1 cells. Smad4 was identified as a potential target mRNA of miR-3074-5p. According to the results of bioinformatics analysis, miR-3074-5p might bind to 3ʹUTR of Smad4 (Fig. 4a). In this study, the expression of Smad4 in MC3T3-E1 cells under iron overload was lower than that in the untreated control group (P < 0.05) (Fig. 4b–d). The expression of Smad4 mRNA and protein in MC3T3-E1 cells under iron overload was further reduced by overexpression of miR-3074-5p achieved by transfecting cells with a miR-3074-5p mimic, and the expression of Smad4 mRNA and protein in MC3T3-E1 cells under iron overload was rescued by inhibition of miR-3074-5p by transfecting cells with a miR-3074-5p inhibitor (Fig. 4b–d), indicating that miR-3074-5p may mediate Smad4 mRNA degradation by 3ʹUTR targeting. Moreover, miR-3074-5p regulates iron overload-promoted apoptosis in MC3T3-E1 cells by targeting Smad4, which was further confirmed by a dual-luciferase reporter assay (Fig. 4e).

Fig. 4
figure 4

Smad4 mRNA and protein were decreased in MC3T3-E1 cells under iron overload and were inversely correlated with miR-3074-5p expression. A Bioinformatics analysis showed that miR-3074-5p might bind to 3ʹUTR region of Smad4. B MC3T3-E1 cells were transfected with the miR-3074-5p inhibitor and NC separately and treated with or without 1.8 mM FAC. Smad4 mRNA was quantified by qRT-PCR. C Cells were transfected with the miR-3074-5p mimic and NC separately and treated with or without 1.8 mM FAC. Smad4 mRNA was quantified by qRT-PCR. *P < 0.05 vs. the NC group. #P < 0.05 vs. the NC + FAC group. D MC3T3-E1 cells were transfected with miR-3074-5p mimic, miR-3074-5p inhibitor and negative control separately and treated with or without 1.8 mM FAC. Smad4 protein was detected by qRT-PCR. E The dual-luciferase report assay demonstrated that miR-3074-5p directly targets the 3ʹUTR of Smad4. The miR-3074-5p mimic repressed the activity of the wild-type (WT) Smad4 3ʹ-UTR (5ʹ…CUGUCAUGAGUGGAGCAGGAAG…3ʹ), but not that of the mutant type (MT) Smad4 3ʹ-UTR (5ʹ…CUGUCAUGAGUGGAGCUCCAAG…3ʹ). *P < 0.05 vs. the NC group

Smad4 attenuated miR-3074-5p mediated apoptosis in MC3T3-E1 cells induced by iron overload

Gain- and loss-of-function experiments were performed by transfecting cells with pcDNA3.1-Smad4 and miR-3074-5p mimic, respectively. The CCK-8 assay was employed to determine the effects of Smad4 on cell viability. The results revealed a significant increase in the inhibition rate of pcDNA3.1-NC + miR-3074-5p mimic-treated MC3T3-E1 cells (pcDNA3.1-NC + mimic group) compared with that of pcDNA3.1-NC-treated MC3T3-E1 cells (pcDNA3.1-NC group) (P < 0.05) (Fig. 5a). The inhibition rate of pcDNA3.1-Smad4 + miR-3074-5p mimic-treated MC3T3-E1 cells (pcDNA3.1-Smad4 + mimic group) was significantly lower than that of pcDNA3.1-NC + miR-3074-5p mimic-treated MC3T3-E1 cells (pcDNA3.1-NC + mimic group) (P < 0.05) (Fig. 5a). Consistently, the expression of pAKT, pERK, p-Stat3, and Smad4 was lower in MC3T3-E1 cells transfected with the pcDNA3.1-NC + miR-3074-5p mimic (pcDNA3.1-NC + mimic group), compared with the pcDNA3.1-NC-treated MC3T3-E1 cells (pcDNA3.1-NC group). Conversely, the expression of pAKT, pERK, p-Stat3, and Smad4 was higher in cells transfected with the pcDNA3.1-Smad4 + miR-3074-5p mimic (pcDNA3.1-Smad4 + mimic group) compared with the pcDNA3.1-NC + miR-3074-5p mimic-treated MC3T3-E1 cells (pcDNA3.1-NC + mimic group) (Fig. 5b). These results indicate that restoration of Smad4 can rescue the viability inhibition of MC3T3-E1 cells mediated by miR-3074-5p under iron overload.

Fig. 5
figure 5

Restoration of Smad4 can rescue the effects of miR-3074-5p on MC3T3-E1 cells. A Gain- and loss-of-function experiments were performed by transfecting cells with pcDNA3.1-Smad4 and the miR-3074-5p mimic, respectively. The CCK-8 assay was used to evaluate the effect of Smad4 on cell viability. *P < 0.05 vs. the pcDNA3.1-NC. #P < 0.05 vs. the pcDNA3.1-NC + mimic group. B Apoptosis-related protein expression levels of cells were evaluated by western blot analysis. C Working model of miR-3074-5p-mediated apoptosis in iron-overloaded MC3T3-E1 cells. miR-3074-5p expression was significantly increased in MC3T3-E1 cells under iron overload conditions. Overexpression of miR-3074-5p induced downregulation of Smad4, the knockdown of which inhibited ERK, AKT and Stat3 phosphorylation, resulting in apoptosis

Discussion

Iron is a necessary auxiliary factor in many biological processes of the human body. Normally, iron metabolism is in a stable state in the human body. In osteoporosis patients, the internal environment of the bone marrow is in an iron overload state. Iron overload-induced osteoblast proliferation inhibition and osteoblast apoptosis are averse to bone remodeling in osteoporosis patients. In vivo and in vitro studies have shown that iron overload inhibits osteoblast proliferation and promotes osteoblast apoptosis. Iron overload induces osteoblast apoptosis by increasing ROS and activating the mitochondrial apoptosis pathway [10, 11]. However, the mechanism of activating the apoptosis pathway by targeting apoptosis-related genes via upstream microRNAs is still unclear. The purpose of this study was to analyze the miRNA expression profiles and evaluate the function of miR-3074-5p in the apoptosis of MC3T3-E1 cells under iron overload conditions and the potential mechanisms.

It has been reported that a high concentration of FAC could cause apoptosis of MC3T3-E1 cells [10, 25]. The results of this study showed that FAC at concentrations above 0.6 mM could induce apoptosis of MC3T3-E1 cells. Caspase 3 is known as one of the effectors of apoptosis. Endogenous, exogenous and endoplasmic reticulum pathways of apoptosis can ultimately activate caspase 3 through different signaling pathways and lead to apoptosis. In this study, the expression of caspase 3 decreased and that of cleaved-caspase 3 increased in FAC-treated MC3T3-E1 cells, suggesting that caspase 3 was activated and induced apoptosis. The IAP family is an inhibitor of apoptosis in cells, and includes XIAP, c-IAP1, c-IAP2, survivin, and NAIP. Among these proteins, c-IAP1 and 2 can inhibit the activation of caspase 9 by interfering with the Apaf-1/cytochrome C complex, thereby inhibiting the activation of caspase 3, while XIAP can directly inhibit the activation of caspase 3 [27]. Survivin can directly inhibit the activation of caspase 3 and caspase 9 [28]. AKT, ERK, and Stat3 play important roles in apoptosis and cell survival. They can inhibit apoptosis and promote cell survival by phosphorylation of themselves and inactivation of their downstream antiapoptotic targets. Apoptosis occurs when the phosphorylation of AKT, ERK, and Stat3 is blocked by stimulating factors [29,30,31]. In this study, the expression levels of XIAP, c-IAP2, and survivin in MC3T3-E1 cells under iron overload decreased, which promoted cell apoptosis.

In recent years, studies have shown that miR-1 regulates apoptosis of nitric oxide treated MC3T3-E1 cells by targeting HSP-70, and miR-335-5p inhibits the high glucose induced apoptosis of MC3T3-E1 cells, but the mechanism is not yet clear. The changes in the miRNA expression profile in the apoptosis of FAC-treated MC3T3-E1 cells and the mechanisms by which miRNAs regulate apoptosis of iron-overloaded MC3T3-E1 cells have not been studied. In this study, we confirmed the upregulation of miR-3074-5p in the apoptosis of MC3T3-E1 cells under iron overload conditions by next-generation sequencing and qRT-PCR. KEGG pathway analysis showed that miRNAs may regulate the apoptosis of iron-overloaded MC3T3-E1 cells by targeting apoptosis-related mRNAs associated with the FoxO and/or mTOR signaling pathways. Target mRNAs of miR-3074-5p were predicted by using bioinformatics analysis. Among the predicted target mRNAs, Smad4 mRNA is related to the FoxO signaling pathway, and its downregulation can promote apoptosis. Previous studies have confirmed that the abrogation of Smad4 in chondrocytes and the blockade of Smad4 in cardiac myocytes result in increased apoptosis [32,33,34].

Smad4 is a key mediator in the signal transduction of transforming factor β (TGF-β)-Smad. Many previous studies have found that the BMP/Smad signaling pathway is involved in the regulation of osteogenic differentiation of osteoblasts. Inhibition of the expression of Smad1 and Smad4 can restrain the osteogenic differentiation of MC3T3-E1 cells [35, 36]. However, there are few studies on whether Smad4 is involved in the regulation of apoptosis in MC3T3-E1 cells. TGF-beta activates ERK in a Smad4-dependent manner and knockdown of Smad4 may inhibit ERK phosphorylation [37, 38]. ERK phosphorylation can promote the expression of antiapoptotic proteins such as Bcl-2 and inhibit the expression of proapoptotic proteins such as Bad. When ERK phosphorylation was blocked, these apoptosis inhibition effects were lost, and apoptosis was promoted. In addition, inhibition of ERK phosphorylation could cause activation of the FOXO transcription factor, leading to cell apoptosis [39]. It has been reported that activation of Smad4 can inhibit AKT phosphorylation and induce apoptosis of gastric cancer cells [40], but no relevant article has suggested that activation of Smad4 can block phosphorylation of Stat3 and lead to apoptosis. In this study, the expression of Smad4 in MC3T3-E1 cells under iron overload conditions was decreased, which could be reversed by inhibition of miR-3074-5p. Moreover, the expression of Smad4 in MC3T3-E1 cells under iron overload conditions was further reduced via overexpression of miR-3074-5p. These results suggested that miR-3074-5p may regulate the degradation of Smad4 mRNA by targeting its 3ʹUTR, which was confirmed by the results of the dual-luciferase reporter assay.

In addition, it has been reported that iron overload can also inhibit the differentiation of MC3T3-E1 cells by inhibiting ALP activity and the expression of colI mRNA and protein [12], but its potential molecular mechanism and related signaling pathways still need to be further elucidated.

Conclusions

In conclusion, this study showed that iron overload induced apoptosis in MC3T3-E1 cells, and miR-3074-5p is involved in viability inhibition of iron-overloaded MC3T3-E1 cells by directly targeting Smad4 (Fig. 5c). Further clinical analysis of miR-3074-5p-Smad4 in patients with osteoporosis should demonstrate the clinical relevance of this study, providing a new idea for solving the problem of bone loss in osteoporosis patients.

Availability of data and materials

All data generated or analyzed during this study are included in this manuscript.

Abbreviations

AKT:

Serine/threonine kinase

c-IAP2:

Cellular inhibitor of apoptosis protein-2

ERK:

Extracellular regulated MAP kinase

FAC:

Ferric ammonium citrate

FoxO:

Forkhead box O

miRNA:

MicroRNA

mTOR:

Mechanistic target of rapamycin kinase

MUT:

Mutant

p-AKT:

Phosphorylated AKT

p-ERK:

Phosphorylated ERK

p-Stat3:

Phosphorylated Stat3

qRT-PCR:

Real-time quantitative reverse transcription PCR

Smad4:

SMAD family member 4

Stat3:

Signal transducer and activator of transcription 3

UTR:

Untranslated region

WT:

Wild type

XIAP:

X-linked inhibitor of apoptosis

References

  1. Liu G, Men P, Kenner GH, Miller SC. Age-associated Iron accumulation in bone: implications for postmenopausal osteoporosis and a new target for prevention and treatment by chelation. Biometals. 2006;19(3):245–51.

    Article  CAS  Google Scholar 

  2. Burge R, Dawson-Hughes B, Solomon DH, Wong JB, King A, Tosteson A. Incidence and economic burden of osteoporosis-related fractures in the United States, 2005–2025. J Bone Miner Res. 2007;22(3):465–75.

    Article  Google Scholar 

  3. Chan YL, Pang LM, Chik KW, Cheng JC, Li CK. Patterns of bone diseases in transfusion-dependent homozygous thalassaemia major: predominance of osteoporosis and desferrioxamine-induced bone dysplasia. Pediatr Radiol. 2002;32(7):492–7.

    Article  Google Scholar 

  4. Vogiatzi MG, Autio KA, Schneider R, Giardina PJ. Low bone mass in prepubertal children with thalassemia major: insights into the pathogenesis of low bone mass in thalassemia. J Pediatr Endocrinol Metab. 2004;17(10):1415–21.

    Article  Google Scholar 

  5. Xu Z, Sun W, Li Y, Ling S, Zhao C, Zhong G, Zhao D, Song J, Song H, Li J, You L, Nie G, Chang Y, Li Y. The regulation of iron metabolism by hepcidin contributes to unloading-induced bone loss. Bone. 2017;94:152–61.

    Article  CAS  Google Scholar 

  6. Schnitzler CM, Schnaid E, MacPhail AP, Mesquita JM, Robson HJ. Ascorbic acid deficiency, iron overload and alcohol abuse underlie the serve osteoporosis in black African patients with hip fractures—a bone histomorphometric study. Calcif Tissue Int. 2005;76(2):79–89.

    Article  CAS  Google Scholar 

  7. Isomura H, Fujie K, Shibata K, Inoue N, Iizuka T, Takebe G, Takahashi K, Nishihira J, Izumi H, Sakamoto W. Bone metabolism and oxidative stress in postmenopausal rats with iron overload. Toxicology. 2004;197(2):93–100.

    Article  CAS  Google Scholar 

  8. Jeney V. Clinical impact and cellular mechanisms of iron overload-associated bone loss. Front Pharmacol. 2017;8:77.

    Article  Google Scholar 

  9. Tsay J, Yang Z, Ross FP, Cunningham-Rundles S, Lin H, Coleman R, Mayer-Kuckuk P, Doty SB, Grady RW, Giardina PJ, Boskey AL, Vogiatzi MG. Bone loss caused by iron overload in a murine model: importance of oxidative stress. Blood. 2010;116(14):2582–9.

    Article  CAS  Google Scholar 

  10. Ke JY, Cen WJ, Zhou XZ, Li YR, Kong WD, Jiang JW. Iron overload induces apoptosis of murine preosteoblast cells via ROS and inhibition of AKT pathway. Oral Dis. 2017;23(6):784–94.

    Article  Google Scholar 

  11. Tian Q, Wu S, Dai Z, Yang J, Zheng J, Zheng Q, Liu Y. Iron overload induced death of osteoblasts in vitro: involvement of the mitochondrial apoptotic pathway. Peer J. 2016;4:e2611.

    Article  Google Scholar 

  12. Yamasaki K, Hagiwara H. Excess iron inhibits osteoblast metabolism. Toxicol Lett. 2009;191(2–3):211–5.

    Article  CAS  Google Scholar 

  13. Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet. 2011;12(2):99–110.

    Article  CAS  Google Scholar 

  14. Krol J, Loedige I, Filipowicz W. The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet. 2010;11(9):597–610.

    Article  CAS  Google Scholar 

  15. Li Z, Rana TM. Therapeutic targeting of microRNAs: current status and future challenges. Nat Rev Drug Discov. 2014;13(8):622–38.

    Article  CAS  Google Scholar 

  16. MicroRNAs GP. MicroRNAs: recently discovered key regulators of proliferation and apoptosis in animal cells: Identification of miRNAs regulating growth and survival. Cytotechnology. 2007;53(1–3):55–63.

    Google Scholar 

  17. Subramanian S, Steer CJ. MicroRNAs as gatekeepers of apoptosis. J Cell Physiol. 2010;223(2):289–98.

    CAS  PubMed  Google Scholar 

  18. Lynam-Lennon N, Maher SG, Reynolds JV. The roles of microRNA in cancer and apoptosis. Biol Rev. 2009;84(1):55–71.

    Article  Google Scholar 

  19. Lee YE, Hong CY, Lin YL, Chen RM. MicroRNA-1 participates in nitric oxide-induced apoptotic insults to MC3T3-E1 cells by targeting heat-shock protein-70. Int J Biol Sci. 2015;11(3):246–55.

    Article  CAS  Google Scholar 

  20. Lu XZ, Yang ZH, Zhang HJ, Zhu LL, Mao XL, Yuan Y. MiR-214 protects MC3T3-E1 osteoblasts against H2O2-induced apoptosis by suppressing oxidative stress and targeting ATF4. Eur Rev Med Pharmacol Sci. 2017;21(21):4762–70.

    PubMed  Google Scholar 

  21. Yin N, Zhu L, Ding L, Yuan J, Du L, Pan M, Xue F, Xiao H. MiR-135-5p promotes osteoblast differentiation by targeting HIF1AN in MC3T3-E1 cells. Cell Mol Biol Lett. 2019;24:51.

    Article  Google Scholar 

  22. Li H, Tian X, Wang P, Huang M, Xu R, Nie T. MicroRNA-582-3p negatively regulates cell proliferation and cell cycle progression in acute myeloid leukemia by targeting cyclin B2. Cell Mol Biol Lett. 2019;24:66.

    Article  CAS  Google Scholar 

  23. Zhang X, Ge YL, Zhang SP, Yan P, Tian RH. Downregulation of KDR expression induces apoptosis in breast cancer cells. Cell Mol Biol Lett. 2014;19(4):527–41.

    Article  CAS  Google Scholar 

  24. Sun Y, Wang C, Wang L, Dai Z, Yang K. Arsenic trioxide induces apoptosis and the formation of reactive oxygen species in rat glioma cells. Cell Mol Biol Lett. 2018;23:13.

    Article  Google Scholar 

  25. Cen WJ, Feng Y, Li SS, Huang LW, Zhang T, Zhang W, Kong WD, Jiang JW. Iron overload induces G1 phase arrest and autophagy in murine preosteoblast cells. J Cell Physiol. 2018;233(9):6779–89.

    Article  CAS  Google Scholar 

  26. Yang SY, Lejault P, Chevrier S, Boidot R, Robertson AG, Wong JMY, Monchaud D. Transcriptome-wide identification of transient RNA G-quadruplexes in human cells. Nat Commun. 2018;9(1):4730.

    Article  Google Scholar 

  27. Budihardjo I, Oliver H, Lutter M, Luo X, Wang X. Biochemical pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol. 1999;15:269–90.

    Article  CAS  Google Scholar 

  28. Zhang B, Yin CP, Zhao Q, Yue SW. Upregulation of HIF-1α by hypoxia protect neuroblastoma cells from apoptosis by promoting survivin expression. Asian Pac J Cancer Prev. 2014;15(19):8251–7.

    Article  Google Scholar 

  29. Deng S, Dai G, Chen S, Nie Z, Zhou J, Fang H, Peng H. Dexamethasone induces osteoblast apoptosis through ROS-PI3K/AKT/GSK3beta signaling pathway. Biomed Pharmacother. 2019;110(19):602–8.

    Article  CAS  Google Scholar 

  30. Wang H, Xia W, Long G, Pei Z, Li Y, Wu M, Wang Q, Zhang Y, Jia Z, Chen H. Isoquercitrin ameliorates cisplatin-induced nephrotoxicity via the inhibition of apoptosis, inflammation, and oxidative stress. Front Pharmacol. 2020;11:599416.

    Article  CAS  Google Scholar 

  31. Wang R, Zhang D, Sun K, Peng J, Zhu W, Yin S, Tang D, Wu Y. Amygdalin promotes the activity of T cells to suppress the progression of HBV-related hepatocellular carcinoma via the JAK2/STAT3 signaling pathway. BMC Infect Dis. 2021;21(1):56.

    Article  CAS  Google Scholar 

  32. Zhang J, Tan X, Li W, Wang Y, Wang J, Cheng X, Yang X. Smad4 is required for the normal organization of the cartilage growth plate. Dev Biol. 2005;284(2):311–22.

    Article  CAS  Google Scholar 

  33. Li Y, Du Y, Cao J, Gao Q, Li H, Chen Y, Lu N. MiR-130a inhibition protects rat cardiac myocytes from hypoxia-triggered apoptosis by targeting Smad4. Kardiol Pol. 2018;76(6):993–1001.

    Article  Google Scholar 

  34. Simeone DM, Zhang L, Graziano K, Nicke B, Pham T, Schaefer C, Logsdon CD. Smad4 mediates activation of mitogen-activated protein kinases by TGF-beta in pancreatic acinar cells. Am J Physiol Cell Physiol. 2001;281(1):311–9.

    Article  Google Scholar 

  35. Kato RB, Roy B, De Oliveira FS, Ferraz EP, De Oliveira PT, Kemper AG, Hassan MQ, Rosa AL, Beloti MM. Nanotopography directs mesenchymal stem cells to osteoblast lineage through regulation of microRNA-SMAD-BMP-2 circuit. J Cell Physiol. 2014;229(11):1690–6.

    Article  CAS  Google Scholar 

  36. Kim DY, Park YG, Quan HY, Kim SJ, Jung MS, Chung SH. Ginsenoside Rd stimulates the differentiation and mineralization of osteoblastic MC3T3-E1 cells by activating AMP-activated protein kinase via the BMP-2 signaling pathway. Fitoterapia. 2012;83(1):215–22.

    Article  CAS  Google Scholar 

  37. Li J, Huang J, Dai L, Yu D, Chen Q, Zhang X, Dai K. miR-146a, an IL-1β responsive miRNA, induces vascular endothelial growth factor and chondrocyte apoptosis by targeting Smad4. Arthritis Res Ther. 2012;14(2):R75.

    Article  CAS  Google Scholar 

  38. Balmanno K, Cook SJ. Tumor cell survival signaling by the ERK1/2 pathway. Cell Death Differ. 2009;16(3):368–77.

    Article  CAS  Google Scholar 

  39. Roy SK, Srivastava RK, Shankar S. Inhibition of PI3K/AKT and MAPK/ERK pathways causes activation of FOXO transcription factor, leading to cell cycle arrest and apoptosis in pancreatic cancer. J Mol Signal. 2010;5:10.

    Article  Google Scholar 

  40. Kundu J, Wahab SM, Kundu JK, Choi YL, Erkin OC, Lee HS, Park SG, Shin YK. Tob1 induces apoptosis and inhibits proliferation, migration and invasion of gastric cancer cells by activating Smad4 and inhibiting beta-catenin signaling. Int J Oncol. 2012;41(3):839–48.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

This study was supported by the Department of Biochemistry, Medical College, Jinan University.

Funding

This study was supported by the Science and Technology Planning Project of Guangdong Province, China [Grant nos. 2015A020214015 and 2016A020220015] and the Science and Technology Planning Project of Guangzhou, China [Grant no. 201904010145].

Author information

Authors and Affiliations

Authors

Contributions

YF and PYH performed the experiments and collected data; YF wrote the manuscript; JWJ and SSL provided suggestions and comments on project and manuscript preparation; WDK and WZ participated in project design and provided funds. WJC, PLW and CL participated in manuscript preparation and revision. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Shu-Shu Li or Jian-Wei Jiang.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Results of bioinformatics analysis.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Feng, Y., He, PY., Kong, WD. et al. Apoptosis-promoting properties of miR-3074-5p in MC3T3-E1 cells under iron overload conditions. Cell Mol Biol Lett 26, 37 (2021). https://doi.org/10.1186/s11658-021-00281-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s11658-021-00281-w

Keywords